View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_54 (Length: 250)
Name: NF10441_low_54
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 7422351 - 7422122
Alignment:
| Q |
10 |
gcagagatgaggatagtatatatagtactccaaatgataagaaatggcatggatcataaaaacgaagcttggcgagtcaagtacgtctttcctttacann |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7422351 |
gcagagatgaggatagtatatatagtactccaaatgataagaaatggcatggatcataaaaacgaagcttggcgagtcaagtacgtctttcctttacatt |
7422252 |
T |
 |
| Q |
110 |
nnnnnnnnnatatatttcgaattgtttattgttttttaagcaaatactttaaattaacctaatttcttactatttaattacgagtctgagcaaatgaaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7422251 |
tttttttttatatatttcgaattgtttattgttttttaagcaaatactttaaattaacctaatttcttactatttaattacgagtctgagcaaatgaaaa |
7422152 |
T |
 |
| Q |
210 |
gagtacagaaaaagaatcaaaggagaataa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7422151 |
gagtacagaaaaagaatcaaaggagaataa |
7422122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University