View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_63 (Length: 227)
Name: NF10441_low_63
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 29136315 - 29136122
Alignment:
| Q |
17 |
atgaaggtctttaaatgtagttaagcttgaacgagtttcttcaacaaaactattttccttgattcttttaagttacttttcacatgagtttgttgtcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29136315 |
atgaaggtctttaaatgtagttaagcttgaacgagtttcttcaacaaaactattttccttgattcttttaagttacttttcacttgagtttgttgtcaaa |
29136216 |
T |
 |
| Q |
117 |
acataccatataaatggaaacattagtgcaattgtctcaatattcttaaaacattagtgcttttcactcgtgttctttttctttctatggtgtc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136215 |
acataccatataaatggaaacattagtgcaattgtctcaatattcttaaaacattagtgcttttcactcgtgttctttttctttctatggtgtc |
29136122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University