View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_67 (Length: 210)
Name: NF10441_low_67
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 63 - 120
Target Start/End: Complemental strand, 31024837 - 31024780
Alignment:
| Q |
63 |
cctcttctcgttttaaccaaattttgaacaatttacaattttctatacttcattcatt |
120 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31024837 |
cctcttctcattttaaccaatttttgaacaatttacaattttctatacttcattcatt |
31024780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 120
Target Start/End: Complemental strand, 31072735 - 31072677
Alignment:
| Q |
63 |
cctcttctcgttttaaccaaattttgaac-aatttacaattttctatacttcattcatt |
120 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
31072735 |
cctcttctcgttttaaacaaattttgaacaaatttacaattttctatgcttcattcatt |
31072677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 120
Target Start/End: Complemental strand, 33559890 - 33559833
Alignment:
| Q |
63 |
cctcttctcgttttaaccaaattttgaacaatttacaattttctatacttcattcatt |
120 |
Q |
| |
|
||||||||||| ||| |||||| |||||| |||||||||||||| | ||||||||||| |
|
|
| T |
33559890 |
cctcttctcgtcttacccaaatattgaaccatttacaattttctctgcttcattcatt |
33559833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University