View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_69 (Length: 205)
Name: NF10441_low_69
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 4783354 - 4783181
Alignment:
| Q |
14 |
gcatagggcacagctaattaactaacttaaactaattgatatatacacctaagcttgaattattaatctcaacatgctttcttaatttaaactttcaaaa |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4783354 |
gcatagggcacagctaactaactaacttaaactaattgttatatgcacctaagcttgaattattaatctcaacatgctttcttaatttaaactttcaaaa |
4783255 |
T |
|
| Q |
114 |
gctacaacacctagctttcttctcagttttaaaatatggacctttttgatagacttggtgaatatatcagttgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4783254 |
gctacaacacctagctttcttctcagttttaaaatatggacctttttgatagacttggtgaatatatcagttgt |
4783181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University