View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10441_low_8 (Length: 451)
Name: NF10441_low_8
Description: NF10441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10441_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 231 - 441
Target Start/End: Original strand, 7222190 - 7222403
Alignment:
| Q |
231 |
cacttttccttattcaatcttctccttcttcttattctcatatgtggtttttcatcttaacatggtatcattcgttgtgtagcgatcc---gcagtttgc |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7222190 |
cacttttccttattcaatcttctccttcttcttattctcatatgtgctttttcatcttaacatggtatcattcgttgtgtagcgatcctccgcagtttgc |
7222289 |
T |
|
| Q |
328 |
cttcgttcatcgcaatgccacctagattggctcatgttcctacggttgacccttctctgcatcaaacccctcccttcttcgttcatccgagcgatggtcc |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
7222290 |
cttcgttcatcgcaatgccacctagattggctcatgttcctacggttgacccttctctgcatcaaaccacacccttcttcgttcatccgagcgatggtcc |
7222389 |
T |
|
| Q |
428 |
ttcttccgtctctg |
441 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7222390 |
ttcttccgtctctg |
7222403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University