View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10442_high_12 (Length: 228)
Name: NF10442_high_12
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10442_high_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 33 - 228
Target Start/End: Original strand, 48629449 - 48629644
Alignment:
| Q |
33 |
acagttggagaaatttatggcaggataaataacctggggcagaggcatgagcccttgccatgtttttcatatggcatggagtacatatgtagtgtaagat |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48629449 |
acagttggagaaatgtatggcaggataaataacctggggcagaggcatgagcccttgccatgtttttcatatggcatggagtacatatgtagtgtaagat |
48629548 |
T |
|
| Q |
133 |
tagagttcctcttaaatgtgtaaatggcctctcnnnnnnnccaagacatgtgtatatgaccttgggatatggctttcaacacaatgatttgagcat |
228 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48629549 |
tagagttcctcttacatgtgtaaatggcctctcgaattttccaagacatgtgtatatgaccttgggatatggttttcaacacaatgatttgagcat |
48629644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University