View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10442_low_12 (Length: 228)

Name: NF10442_low_12
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10442_low_12
NF10442_low_12
[»] chr1 (1 HSPs)
chr1 (33-228)||(48629449-48629644)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 33 - 228
Target Start/End: Original strand, 48629449 - 48629644
Alignment:
33 acagttggagaaatttatggcaggataaataacctggggcagaggcatgagcccttgccatgtttttcatatggcatggagtacatatgtagtgtaagat 132  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48629449 acagttggagaaatgtatggcaggataaataacctggggcagaggcatgagcccttgccatgtttttcatatggcatggagtacatatgtagtgtaagat 48629548  T
133 tagagttcctcttaaatgtgtaaatggcctctcnnnnnnnccaagacatgtgtatatgaccttgggatatggctttcaacacaatgatttgagcat 228  Q
    |||||||||||||| ||||||||||||||||||       |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
48629549 tagagttcctcttacatgtgtaaatggcctctcgaattttccaagacatgtgtatatgaccttgggatatggttttcaacacaatgatttgagcat 48629644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University