View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10442_low_13 (Length: 227)
Name: NF10442_low_13
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10442_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 31111465 - 31111368
Alignment:
| Q |
1 |
agggttttttgtgggttctagatttacatattatttcttcaaattttgggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111465 |
agggttttttgtgggttctagatctacatattatttcttcaaatttttggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg |
31111368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 162 - 227
Target Start/End: Complemental strand, 31111305 - 31111240
Alignment:
| Q |
162 |
ataggtttgaagaaaaagaggatgaggaagattaactatgaagatgaatttgaagaaaattattta |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31111305 |
ataggtttgaagaaaaagaggatgaggaagattgactatgaagatgaatttgaagaaaattattta |
31111240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 98
Target Start/End: Complemental strand, 31057487 - 31057393
Alignment:
| Q |
4 |
gttttttgtgggttctagatttacatattatttcttcaaattttgggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg |
98 |
Q |
| |
|
||||||| |||||||||||| || |||| ||||||||| || | ||||||| ||||||||| |||| ||||||||||| ||||||||| |||| |
|
|
| T |
31057487 |
gttttttatgggttctagatctatgtattctttcttcaatttataggttgaaaatgaatgttaagaggaaagttgatgaagatatgtaatgttgg |
31057393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University