View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10442_low_13 (Length: 227)

Name: NF10442_low_13
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10442_low_13
NF10442_low_13
[»] chr6 (3 HSPs)
chr6 (1-98)||(31111368-31111465)
chr6 (162-227)||(31111240-31111305)
chr6 (4-98)||(31057393-31057487)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 31111465 - 31111368
Alignment:
1 agggttttttgtgggttctagatttacatattatttcttcaaattttgggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg 98  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
31111465 agggttttttgtgggttctagatctacatattatttcttcaaatttttggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg 31111368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 162 - 227
Target Start/End: Complemental strand, 31111305 - 31111240
Alignment:
162 ataggtttgaagaaaaagaggatgaggaagattaactatgaagatgaatttgaagaaaattattta 227  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
31111305 ataggtttgaagaaaaagaggatgaggaagattgactatgaagatgaatttgaagaaaattattta 31111240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 98
Target Start/End: Complemental strand, 31057487 - 31057393
Alignment:
4 gttttttgtgggttctagatttacatattatttcttcaaattttgggttgaagatgaatgttttgagggaagttgatgaaaatatgtaatcttgg 98  Q
    ||||||| |||||||||||| ||  |||| ||||||||| || | ||||||| |||||||||  |||| ||||||||||| ||||||||| ||||    
31057487 gttttttatgggttctagatctatgtattctttcttcaatttataggttgaaaatgaatgttaagaggaaagttgatgaagatatgtaatgttgg 31057393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University