View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10442_low_8 (Length: 239)

Name: NF10442_low_8
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10442_low_8
NF10442_low_8
[»] chr7 (1 HSPs)
chr7 (75-202)||(41929245-41929372)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 41929372 - 41929245
Alignment:
75 cttaatagtaatttggagtggatttgacctaattggtgtttattgtcctaattctattttgtgatgatgattaactgttgagctttgtggtgatttgttg 174  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41929372 cttaataataatttggagtggatttgacctaattggtgtttattgtcctaattctattttgtgatgatgattaactgttgagctttgtggtgatttgttg 41929273  T
175 gtgaattatattttcattgtatgcattg 202  Q
    ||||||||||||||||||||||||||||    
41929272 gtgaattatattttcattgtatgcattg 41929245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University