View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10442_low_8 (Length: 239)
Name: NF10442_low_8
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10442_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 41929372 - 41929245
Alignment:
| Q |
75 |
cttaatagtaatttggagtggatttgacctaattggtgtttattgtcctaattctattttgtgatgatgattaactgttgagctttgtggtgatttgttg |
174 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41929372 |
cttaataataatttggagtggatttgacctaattggtgtttattgtcctaattctattttgtgatgatgattaactgttgagctttgtggtgatttgttg |
41929273 |
T |
 |
| Q |
175 |
gtgaattatattttcattgtatgcattg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41929272 |
gtgaattatattttcattgtatgcattg |
41929245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University