View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10442_low_9 (Length: 239)
Name: NF10442_low_9
Description: NF10442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10442_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 52251573 - 52251366
Alignment:
| Q |
19 |
gagcaaagcaacgttcgagtttatatgccaagaacttgaatcagctgtttcaaagaaaaacactttgctaagggatgcaattccggggcggcagcgcgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52251573 |
gagcaaagcaacgttcgagtttatatgccaagaacttgaatcagctgtttcaaagaaaaacactttgctaagggatgcaattccggggcggcagcgcgtg |
52251474 |
T |
 |
| Q |
119 |
gcggtttgtatctggagactcgccaccggtgatcctctaaggctggtttcaaagaggttcggtttgggtatatccacctgtcataagctggttcttgagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52251473 |
gcggtttgtatctggagactcgccaccggtgatcctctaaggctggtttcaaagaggttcggtttgggtatatccacctgtcataagctggttcttgagg |
52251374 |
T |
 |
| Q |
219 |
tctgtgct |
226 |
Q |
| |
|
| |||||| |
|
|
| T |
52251373 |
tttgtgct |
52251366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University