View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10444_low_11 (Length: 366)
Name: NF10444_low_11
Description: NF10444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10444_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 74 - 204
Target Start/End: Complemental strand, 28479686 - 28479555
Alignment:
| Q |
74 |
gtggcactgtcaaatttggcacatatgaaagtatactatcacacattttggcataattcattgctt-agtgtgagttgacgtaaaaggctccttaattaa |
172 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||| ||||||||||||||||||| ||||||| | ||||||||||| || |||||||||||||||| |
|
|
| T |
28479686 |
gtggcactgtcaaatttggggcataagacagtatactaccacacattttggcataatttattgcttcaatgtgagttgacctagaaggctccttaattaa |
28479587 |
T |
 |
| Q |
173 |
gctaactgaaccatattgaaatattgtggcct |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
28479586 |
gctaactgaaccataatgaaatattgtggcct |
28479555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 202 - 290
Target Start/End: Complemental strand, 28479007 - 28478918
Alignment:
| Q |
202 |
ccttctttatgagactcttg-caatttcttctggacgaaaaagtatgtcagcatttggatttcgataaaacatcaattcaggttttccat |
290 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||| ||||||||||||||| | ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
28479007 |
ccttttttatgagactcttgtcaatttcttctgaacggaaaagtatgtcagcactaggatttcgataaaacatgaattcaggtttcccat |
28478918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University