View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10444_low_11 (Length: 366)

Name: NF10444_low_11
Description: NF10444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10444_low_11
NF10444_low_11
[»] chr7 (2 HSPs)
chr7 (74-204)||(28479555-28479686)
chr7 (202-290)||(28478918-28479007)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 74 - 204
Target Start/End: Complemental strand, 28479686 - 28479555
Alignment:
74 gtggcactgtcaaatttggcacatatgaaagtatactatcacacattttggcataattcattgctt-agtgtgagttgacgtaaaaggctccttaattaa 172  Q
    |||||||||||||||||||  |||| || ||||||||| ||||||||||||||||||| ||||||| | ||||||||||| || ||||||||||||||||    
28479686 gtggcactgtcaaatttggggcataagacagtatactaccacacattttggcataatttattgcttcaatgtgagttgacctagaaggctccttaattaa 28479587  T
173 gctaactgaaccatattgaaatattgtggcct 204  Q
    ||||||||||||||| ||||||||||||||||    
28479586 gctaactgaaccataatgaaatattgtggcct 28479555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 202 - 290
Target Start/End: Complemental strand, 28479007 - 28478918
Alignment:
202 ccttctttatgagactcttg-caatttcttctggacgaaaaagtatgtcagcatttggatttcgataaaacatcaattcaggttttccat 290  Q
    |||| ||||||||||||||| |||||||||||| ||| ||||||||||||||| | ||||||||||||||||| ||||||||||| ||||    
28479007 ccttttttatgagactcttgtcaatttcttctgaacggaaaagtatgtcagcactaggatttcgataaaacatgaattcaggtttcccat 28478918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University