View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10444_low_17 (Length: 275)

Name: NF10444_low_17
Description: NF10444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10444_low_17
NF10444_low_17
[»] chr1 (1 HSPs)
chr1 (48-172)||(8444534-8444656)


Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 48 - 172
Target Start/End: Original strand, 8444534 - 8444656
Alignment:
48 gttttcacaaatacgagatcatatttaagtaactcgtatattttccttcaatgttgaacaaaaattatgtaacctt-nnnnnnntcacacatatataaac 146  Q
    |||||||||| ||||| ||||||||||| ||||||||||||||| ||||||||||||  |||||| ||||||||||        |||||| |||||||||    
8444534 gttttcacaa-tacgatatcatatttaaataactcgtatattttgcttcaatgttga--aaaaataatgtaaccttaaaaaatatcacacttatataaac 8444630  T
147 tttttatgaataaacaaccattttaa 172  Q
    ||||||||||||||||||||||||||    
8444631 tttttatgaataaacaaccattttaa 8444656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University