View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10444_low_17 (Length: 275)
Name: NF10444_low_17
Description: NF10444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10444_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 48 - 172
Target Start/End: Original strand, 8444534 - 8444656
Alignment:
| Q |
48 |
gttttcacaaatacgagatcatatttaagtaactcgtatattttccttcaatgttgaacaaaaattatgtaacctt-nnnnnnntcacacatatataaac |
146 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||||||||||||||| |||||||||||| |||||| |||||||||| |||||| ||||||||| |
|
|
| T |
8444534 |
gttttcacaa-tacgatatcatatttaaataactcgtatattttgcttcaatgttga--aaaaataatgtaaccttaaaaaatatcacacttatataaac |
8444630 |
T |
|
| Q |
147 |
tttttatgaataaacaaccattttaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8444631 |
tttttatgaataaacaaccattttaa |
8444656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University