View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10444_low_28 (Length: 220)
Name: NF10444_low_28
Description: NF10444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10444_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 36534411 - 36534612
Alignment:
| Q |
1 |
acggtggttgattttcttgaagaaatgaagaatgcctgtaaagctgctcaacctagattgaaagttcgtacaatgaaggttgaaatagataatggaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534411 |
acggtggttgattttcttgaagaaatgaagaatgcctgtaaagctgctcaacctaaattgaaagttcgtacaatgaaggttgaaatagataatggaaaag |
36534510 |
T |
|
| Q |
101 |
atagggctaacactattctcttacataccttagatcaaggggttgatgttgtagttataggccaaaaacgcactctttcttccacattattagggtaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534511 |
atagggctaacactattctcttacataccttagatcaacgggttgatgttgtagttataggccaaaaacgcactctttcttccacattattagggtaagt |
36534610 |
T |
|
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
36534611 |
at |
36534612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University