View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10445_high_11 (Length: 238)
Name: NF10445_high_11
Description: NF10445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10445_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 8756295 - 8756517
Alignment:
| Q |
1 |
catgaaacgtgtcttcaccatcataccagctgcagccttccgtaaaacatcctcccatctagaaaactctattggtgatgtttcatggcttcttcgagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756295 |
catgaaacgtgtcttcaccatcataccagctgcagccttccgtaaaacatcctcccatctagaaaactctattggtgatgtttcatggcttcttcgagta |
8756394 |
T |
 |
| Q |
101 |
tctgcccccgctgatgatcgcggtggcgagtatcttggacttccaccaatagcagccaatgaacctatattatgttttatatgggagcagatcgctatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756395 |
tctgcccccgctgatgatcgcggtggcgagtatcttggacttccaccaatagcagccaatgaacctatattatgttttatatgggagcagatcgctatgt |
8756494 |
T |
 |
| Q |
201 |
tattcaccggttcacaagaagtt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8756495 |
tattcaccggttcacaagaagtt |
8756517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University