View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10445_high_9 (Length: 250)
Name: NF10445_high_9
Description: NF10445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10445_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 8756210 - 8755995
Alignment:
| Q |
1 |
cgttcgtagagatcagagctcgctcttgctgcttgacggagaagagtagcgagtttttctgttttggatttgagctcagaacattcttgtttgaatgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756210 |
cgttcgtagagatcagagctcgctcttgctgcttgacggagaagagtagcgagtttttctgttttggatttgagctcagaacattcttgtttgaatgaac |
8756111 |
T |
 |
| Q |
101 |
ttgcttcatctgctgattttgttacttggtctgctagttggatcggttttgctaatatttgtttcactatgtcacccatttgatgttggatcaattcaat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756110 |
ttgcttcatctgctgcttttgttacttggtctgctagttggatcggttttgctaatatttgtttcactatgtcacccatttgatgttggatcaattcaat |
8756011 |
T |
 |
| Q |
201 |
atcaactcgatttgtt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8756010 |
atcaactcgatttgtt |
8755995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 32032192 - 32032367
Alignment:
| Q |
1 |
cgttcgtagagatcagagctcgctcttgctgcttgacggagaagagtagcgagtttttctgttttggatttgagctcagaacattcttgtttgaa---tg |
97 |
Q |
| |
|
|||||||| | ||| ||||| | |||||| ||||| |||||||||| |||||||||||| ||||| |||||||| || ||||||||||||||| || |
|
|
| T |
32032192 |
cgttcgtataaatcggagcttgatcttgcagcttgtcggagaagagaagcgagtttttcggtttttgatttgaggtctagacattcttgtttgaaagatg |
32032291 |
T |
 |
| Q |
98 |
aacttgcttcatctgctgattttgttacttggtctgctagttggatcggttttgctaatatttgtttcactatgtc |
173 |
Q |
| |
|
| ||| |||| || |||| ||| |||||||||||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
32032292 |
agcttccttcttcagctgctttgcttacttggtctgctagttggatcggttttgctaacaattgtttaactatgtc |
32032367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University