View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10445_low_13 (Length: 248)

Name: NF10445_low_13
Description: NF10445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10445_low_13
NF10445_low_13
[»] chr3 (4 HSPs)
chr3 (1-60)||(2642987-2643046)
chr3 (1-59)||(2503555-2503613)
chr3 (15-49)||(2632027-2632061)
chr3 (1-46)||(7332589-7332634)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 2643046 - 2642987
Alignment:
1 tacacacttctctggtatgatagtgttgattactgcaaattaataattaaagtatatacg 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2643046 tacacacttctctggtatgatagtgttgattactgcaaattaataattaaagtatatacg 2642987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 2503555 - 2503613
Alignment:
1 tacacacttctctggtatgatagtgttgattactgcaaattaataattaaagtatatac 59  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
2503555 tacacacttctctggtatgatagcgttgattactgcaaattaataattaaagtatatac 2503613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 49
Target Start/End: Original strand, 2632027 - 2632061
Alignment:
15 gtatgatagtgttgattactgcaaattaataatta 49  Q
    |||||||||||||||||||||||||||||||||||    
2632027 gtatgatagtgttgattactgcaaattaataatta 2632061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 7332634 - 7332589
Alignment:
1 tacacacttctctggtatgatagtgttgattactgcaaattaataa 46  Q
    |||||||||||||||||||||||   |||||| |||||||||||||    
7332634 tacacacttctctggtatgatagcagtgattattgcaaattaataa 7332589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University