View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10445_low_18 (Length: 235)

Name: NF10445_low_18
Description: NF10445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10445_low_18
NF10445_low_18
[»] chr6 (1 HSPs)
chr6 (18-129)||(15116133-15116244)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 15116133 - 15116244
Alignment:
18 aagaaaaccaattattaagttaagatgttttgaaaagtttgggttagagataatttcataatcataatggtttttgcagctataatggaacatgttcatt 117  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||    
15116133 aagaaaaccgattattaagttaagatgttttgaaaagtttgggttagagataatttcataatcataatggtttttgcaacgataatggaacacgttcatt 15116232  T
118 ggtttttgcaga 129  Q
    ||||||||||||    
15116233 ggtttttgcaga 15116244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University