View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10445_low_18 (Length: 235)
Name: NF10445_low_18
Description: NF10445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10445_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 15116133 - 15116244
Alignment:
| Q |
18 |
aagaaaaccaattattaagttaagatgttttgaaaagtttgggttagagataatttcataatcataatggtttttgcagctataatggaacatgttcatt |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
15116133 |
aagaaaaccgattattaagttaagatgttttgaaaagtttgggttagagataatttcataatcataatggtttttgcaacgataatggaacacgttcatt |
15116232 |
T |
|
| Q |
118 |
ggtttttgcaga |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15116233 |
ggtttttgcaga |
15116244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University