View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10446_low_10 (Length: 237)
Name: NF10446_low_10
Description: NF10446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10446_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 49016892 - 49017102
Alignment:
| Q |
16 |
tctttttcatttatttttaaaaaatattatgccaatagagatgcaaatattttgatagtttataataagttatcatctccgtctcacaagaagtgactca |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49016892 |
tctttttcatttatttttaaaaaaaattatgccaatagagatgcaaatattttgatagttta--ataagttatcatctccgtctcacaagaagtgactca |
49016989 |
T |
 |
| Q |
116 |
tttatttatattaaaaattgtttcaaaacgaatgattttgaccgtccgtgaacttgtagcaccatactgcaactgtagaggatccaagcacatagctttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||| |
|
|
| T |
49016990 |
tttatttatattaaaaattgtttcaaaacgaatgattctgaccgtccgtgaacttgtagcaccatact---accgtagaggatccaagcacataactttg |
49017086 |
T |
 |
| Q |
216 |
tacattagctttaatt |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49017087 |
tacattagctttaatt |
49017102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University