View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10446_low_6 (Length: 378)
Name: NF10446_low_6
Description: NF10446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10446_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 7e-65; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 223 - 356
Target Start/End: Original strand, 19710216 - 19710349
Alignment:
| Q |
223 |
cttgatgtccctatttttagaggcaagcccaagaaagtttatcttcaacctattgcagacaaggtgaaactgaaacttgtctcatggaaagcttcacttc |
322 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19710216 |
cttggtgtccctatttttagaggcaagcccaagaaagtttatcttcaacctattgcagacaaggtgaaactgaaacttgtatcatggaaagcttcacttc |
19710315 |
T |
|
| Q |
323 |
tttcaattgcatggagggttcaattagtgaaatc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19710316 |
tttcaattgcatggagggttcaattagtgaaatc |
19710349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 123 - 191
Target Start/End: Original strand, 19710152 - 19710220
Alignment:
| Q |
123 |
ttaacaaatcaactactatgctggagctattagcaatgctaggcttcttcacatctctgatatgcttgg |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19710152 |
ttaacaaatcaactactatactggagctattagcaatgctaggcttcttcacatctctgatatgcttgg |
19710220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 19710032 - 19710071
Alignment:
| Q |
17 |
aaatatatggcggagtaaagaattaatatgtagttaagag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19710032 |
aaatatatggcggagtaaagaattaatatgtagttaagag |
19710071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University