View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10446_low_9 (Length: 254)
Name: NF10446_low_9
Description: NF10446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10446_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 71 - 242
Target Start/End: Complemental strand, 37313028 - 37312858
Alignment:
| Q |
71 |
tacaaaacaaaacataagtatataattttggttactttcttagtttgcctatggatacaaggatttttcgtcaaaactttatggcgagaattttcaaaat |
170 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37313028 |
tacaaaacaaaacataag-atataattttggttactttcttagtttgcctaaggatacaaggatttttcgtcaaaactttatggcgagaattttcaaaat |
37312930 |
T |
 |
| Q |
171 |
ctaatataatatttattagtgtaaattataatctcctctcttgaaagatgtttgaactacattattcttctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37312929 |
ctaatataatatttattagtgtaaattataatctcctctcttgaaagttgtttgaactacattattcttctc |
37312858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 37316311 - 37316241
Alignment:
| Q |
1 |
tagggtctaggttgacaataacttccacatgcatacgtgtcaataacataacataacccctaaaagaacat |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37316311 |
tagggtctaggttgacaataacttccacatgcatacgtgtcaataacataacataacccctaaaagaacat |
37316241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University