View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_high_10 (Length: 296)
Name: NF10447_high_10
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 284
Target Start/End: Original strand, 45548264 - 45548532
Alignment:
| Q |
16 |
ctttctctggtatttacacgctatttctttcatggatggctttgagatccgacttcaagtctgggactgggaggtgcatgtaacgccacctgcgggcgta |
115 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45548264 |
ctttctccggtatttccacgctatttctttcatggatggctttgagatccgacttcaagtctgggactgggagatgcatgtaacgccacctgcgggcgta |
45548363 |
T |
 |
| Q |
116 |
gttttgtctatttgaaattgtctttggataactcaaatatgagaaagtaatgtcgataaatcattttataagaaatgtactcaatttaaaagattttact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548364 |
gttttgtctatttgaaattgtctttggataactcaaatatgagaaagtaatgtcgataaatcattttataagaaatgtactcaatttaaaagattttact |
45548463 |
T |
 |
| Q |
216 |
ccatgttaaagttttatagtaacttaataaaggaggaaactcttctttctaatgaaaacttgctgttca |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548464 |
ccatgttaaagttttatagtaacttaataaaggaggaaactcttctttctaatgaaaacttgctgttca |
45548532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University