View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10447_high_18 (Length: 238)

Name: NF10447_high_18
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10447_high_18
NF10447_high_18
[»] chr1 (2 HSPs)
chr1 (139-222)||(32260111-32260194)
chr1 (1-43)||(32260698-32260740)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 139 - 222
Target Start/End: Complemental strand, 32260194 - 32260111
Alignment:
139 tgtctcataattgatgttcgactcagtgagacaaaccaagaagaagcaagggtttaactcattaatttctttatggggatgaat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32260194 tgtctcataattgatgttcgactcagtgagacaaaccaagaagaagcaagggtttaactcattaatttctttatggggatgaat 32260111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 32260740 - 32260698
Alignment:
1 aacacattattattagaaaagttcataatgtaatgcgtggatg 43  Q
    ||||||||||||||||||||||||||||| |||||||||||||    
32260740 aacacattattattagaaaagttcataatataatgcgtggatg 32260698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University