View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_low_20 (Length: 262)
Name: NF10447_low_20
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 23666888 - 23667131
Alignment:
| Q |
1 |
tatctctcctctccgtgtctttgtactacgtaggcagtaaatagttacctcagattccaaaaatgtcggtgtgtgtgggtctcaaagaagaaacatatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23666888 |
tatctctcctctccgtgtctttgtactacgtaggcagtaaatagttacctcagattccaaaaatgtcggtgtgtgtgggtctcaaagaagaaacatatcg |
23666987 |
T |
 |
| Q |
101 |
aaagataaagcaaaaagaagcaagtaaataacacagcagtgtgggctaattttgcagaagctataatatatggtacgaaaatgaggctcagaaattcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23666988 |
aaagataaagcaaaaagaagcaagtaaataacacagcagtgtgggctaattttgcagaagctataatatatggtacgaaaatgaggctcagaaattcatg |
23667087 |
T |
 |
| Q |
201 |
catgttctactttcatggatatgtgaactgttcaactgttacat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23667088 |
catgttctactttcatggatatgtgaactgttcaactgttacat |
23667131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University