View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_low_23 (Length: 254)
Name: NF10447_low_23
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 254
Target Start/End: Original strand, 42237968 - 42238202
Alignment:
| Q |
20 |
gtagagagaacagaatcatcagattcagagaagagtgaggatgatgatgaagatgatggtggctcagaatcaaaacgtaggaaagttaagaaccttggtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237968 |
gtagagagaacagaatcatcagattcagagaagagtgaggataatgatgaagatgatggtggctcagaatcaaaacgtaggaaagttaagaaccttggtt |
42238067 |
T |
 |
| Q |
120 |
caagcataatgaggagtgcatcagtgttggcaagggctctaagaagatgtgaagagaagaaggagaaacggcaccgtgaattgattgagcttgaacaaag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42238068 |
caagcataatgaggagtgcatcagtgttggcaagggctctaagaagatgtgaagagaagaaggagaaacggcaccgtgaattgatcgagcttgaacaaag |
42238167 |
T |
 |
| Q |
220 |
acggattcaaatggaggaatctcggaacgaagttc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42238168 |
acggattcaaatggaggaatctcggaacgaagttc |
42238202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University