View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_low_27 (Length: 245)
Name: NF10447_low_27
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 44283255 - 44283028
Alignment:
| Q |
1 |
cctgttgtatcagatgctaattcaaagtttgtgaatacatatgtagctgattgtttagttagtgccaccagaggtaacagtatcactatcactgctccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44283255 |
cctgttgtatcagatgctaattcaaagtttgtgaatacatatgtagctgattgtttagttagtgccaccagaggtaacagtatcactatcactgctccac |
44283156 |
T |
|
| Q |
101 |
caataacctgacacggaaaattgagtgtgttacttcctaataaaagctnnnnnnnngttgagcaaattttgaagcacatcttagaatatttttggtagaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44283155 |
caataacctgacacagaaaattgagtgtgttacttcctaataaaagct-caaaaaagttgagcaaattttgaagcacatcttagaacatttttggtagaa |
44283057 |
T |
|
| Q |
201 |
agaacaatgaagtgtttggctgcagtcac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44283056 |
agaacaatgaagtgtttggctgcagtcac |
44283028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University