View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_low_29 (Length: 242)
Name: NF10447_low_29
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 3809764 - 3809986
Alignment:
| Q |
20 |
cggagttatacgacgccattcaagtacacttaagccatatttaaaagaggaaaatatgattgctcgtttaaggttttgtttgtcaatgctcgaccgtaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3809764 |
cggagttatacgacgccattcaagtacacttaagccatatttaaaagaggaaaatatgattgctcgtttaaggttttgtttgtcaatgctcgaccgtaac |
3809863 |
T |
 |
| Q |
120 |
agctcgcctcatgatccgaagtttacttccatgcacaatactgtgtttatcgatgagaaatggttctatattacaaaaaataaaaccaattactatttgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3809864 |
agctcgcctcatgatccgaagtttacttccatgcacaatactgtgtttatcgatgagaaatggttctatattacaaaaaataaaaccaattactatttga |
3809963 |
T |
 |
| Q |
220 |
attcggaagaggaggagccacac |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3809964 |
attcggaagaggaggagccacac |
3809986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University