View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_low_32 (Length: 238)
Name: NF10447_low_32
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 139 - 222
Target Start/End: Complemental strand, 32260194 - 32260111
Alignment:
| Q |
139 |
tgtctcataattgatgttcgactcagtgagacaaaccaagaagaagcaagggtttaactcattaatttctttatggggatgaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32260194 |
tgtctcataattgatgttcgactcagtgagacaaaccaagaagaagcaagggtttaactcattaatttctttatggggatgaat |
32260111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 32260740 - 32260698
Alignment:
| Q |
1 |
aacacattattattagaaaagttcataatgtaatgcgtggatg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32260740 |
aacacattattattagaaaagttcataatataatgcgtggatg |
32260698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University