View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10447_low_36 (Length: 203)
Name: NF10447_low_36
Description: NF10447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10447_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 12326348 - 12326180
Alignment:
| Q |
17 |
agagagaatggccaacaccaggtttgtgtcgatagagtgaaagccgttgcagacagaataaaagtcttgaatattgtacttagtaacgagactctttcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12326348 |
agagagaatggccaacaccaggtttgtgtcgatagagtgaaagccgttgcagacagaataaaagtcttgaatattgtacttagtaacgagactctttcac |
12326249 |
T |
 |
| Q |
117 |
ctaatatatattaagatgagcttaagtccaaacaaattcctaagctctacaaatttggatacagaactc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12326248 |
ctaatatatattaagatgagcttaagtccaaacaaattcctaagctctacaaatttggatacagaactc |
12326180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University