View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10449_high_9 (Length: 236)
Name: NF10449_high_9
Description: NF10449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10449_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32214993 - 32215219
Alignment:
| Q |
1 |
aaatttttcagcaaaaagagcaaactcaaaaacatttacttgacaattgtaagcttcagtcttt-----ggttgaaatcggaatattccaagttcagttt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32214993 |
aaatttttcagcaaaaagagcaaactcaaaaacatttacttgacaatattaagcttcagtctttttggtggttgaaatcggaatattccaagttcagttt |
32215092 |
T |
 |
| Q |
96 |
cgactatcatctttcaagacttaatcctcttatgtgtttgaaagtgtttacttagaatgtttttatgtttctttttggactttggttattgttgtaattg |
195 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32215093 |
cgactatcatctttcaaggcttaatcctcttatgtgtttgaaagcgtttacttaaaatgtttttatgtttctttttggactttggttattgttgtaattg |
32215192 |
T |
 |
| Q |
196 |
tgtaaactttttcaactatcaactttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32215193 |
tgtaaactttttcaactatcaactttc |
32215219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 123 - 206
Target Start/End: Original strand, 14692280 - 14692369
Alignment:
| Q |
123 |
tcttatgtgtttgaaagtgtttacttagaatgtttttatgtttctttttg------gactttggttattgttgtaattgtgtaaactttt |
206 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | ||| ||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
14692280 |
tcttatgtgtctgaaagtggttacttagaacgctttcgtgtttctttgtgtccgcggactttggttattgttgtaattgtgtaaactttt |
14692369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University