View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10449_low_11 (Length: 243)
Name: NF10449_low_11
Description: NF10449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10449_low_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 39000049 - 39000282
Alignment:
| Q |
18 |
aaaggagcttgaggcagtaggtaaaaaataaagaatggagcatgaaaatgaatagagaaagagcatgatgatgtacatgtttgtttgggtgccacttttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000049 |
aaaggagcttgaggcagtaggtaaaaaataaagaatggagcatgaaaatgaatagagaaagagcatgatgatgtacatgtttgtttgggtgccacttttc |
39000148 |
T |
|
| Q |
118 |
ttttggttgctactctttcattgagtaaatcacaattttggt--------gtgtgatactatatcaatatagtctttgaatatatcaaaataactaaaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000149 |
ttttggttgctactctttcattgagtaaatcataattttggttacaaaacgtgtgatactatatcaatatagtctttgaatatatcaaaataactaaaat |
39000248 |
T |
|
| Q |
210 |
gttactgaatatatcttttattagtaattttatt |
243 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
39000249 |
attactgaatatatcttttgttagtaattttatt |
39000282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University