View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10449_low_14 (Length: 229)
Name: NF10449_low_14
Description: NF10449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10449_low_14 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 87 - 229
Target Start/End: Complemental strand, 43009409 - 43009267
Alignment:
| Q |
87 |
ttttttcttatgaaagaatctaatggcaaaacttacacatatttagtgtaaaaaagaggggtattatatgtatgtacgaactcgctctcggtatatcaaa |
186 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
43009409 |
tttttttttatgaaagaatctaatggcaaaacttacacatatttaatgtaaaaaagaggggtattacatgcatgtacgaactcgctctcagtatatcaaa |
43009310 |
T |
|
| Q |
187 |
catcttgcaattataaattgagttgtgttatcgagactatata |
229 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43009309 |
cctctcgcaattataaattgagttgtgttatcgagattatata |
43009267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 6 - 61
Target Start/End: Complemental strand, 43009604 - 43009549
Alignment:
| Q |
6 |
ataaagaccctctaaaaacaaatatatgttgttttgtttaagcaaactagtttact |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43009604 |
ataaagaccctctaaaaacaaatatatgttgttttgtttaagcaaactagtttact |
43009549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 91
Target Start/End: Complemental strand, 43009503 - 43009468
Alignment:
| Q |
56 |
tttactggatacaaattctatgtacaattcattttt |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43009503 |
tttactggatacaaattctatgtacaaatcattttt |
43009468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University