View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10449_low_15 (Length: 228)
Name: NF10449_low_15
Description: NF10449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10449_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 44125257 - 44125449
Alignment:
| Q |
13 |
ggacgttggagaagcttacggctatggcgatgcgagcgagttggccaggattctgttgaactgcattggcgtaacgagagagggaagtgtagcatatgtc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44125257 |
ggactttggagaagcttacggctatggcgatgcgagcgagttggccaggattctgttgaactgcattggcgtaacgagagagggaagtgtagcatatgtc |
44125356 |
T |
|
| Q |
113 |
agggtagagtgttgcgttgcaacttgaacggatgaattcggcgtcgtcgttggtggtggtcggaggttctgctccggtggcggttgttgaacg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44125357 |
agggtagagtgttgcgttgcaacttgaacggatgaattcggcgtcgtcgttggtggtggtcggaggttctgctccggtggcggttgtcgaacg |
44125449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 162
Target Start/End: Original strand, 50037123 - 50037272
Alignment:
| Q |
13 |
ggacgttggagaagcttacggctatggcgatgcgagcgagttggccaggattctgttgaactgcattggcgtaacgagagagggaagtgtagcatatgtc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50037123 |
ggactttggagaagcttacggctatggcgatgcgagcgagttggccaggattctgttgaactgcattggcgtaacgagagagggaagtgtagcatatgtc |
50037222 |
T |
|
| Q |
113 |
agggtagagtgttgcgttgcaacttgaacggatgaattcggcgtcgtcgt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50037223 |
agggtagagtgttgcgttgcaacttgaacggatgaattcggcgtcgtcgt |
50037272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 162
Target Start/End: Original strand, 50044345 - 50044494
Alignment:
| Q |
13 |
ggacgttggagaagcttacggctatggcgatgcgagcgagttggccaggattctgttgaactgcattggcgtaacgagagagggaagtgtagcatatgtc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50044345 |
ggactttggagaagcttacggctatggcgatgcgagcgagttggccaggattctgttgaactgcattggcgtaacgagagagggaagtgtagcatatgtc |
50044444 |
T |
|
| Q |
113 |
agggtagagtgttgcgttgcaacttgaacggatgaattcggcgtcgtcgt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50044445 |
agggtagagtgttgcgttgcaacttgaacggatgaattcggcgtcgtcgt |
50044494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University