View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10449_low_16 (Length: 227)
Name: NF10449_low_16
Description: NF10449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10449_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 39000385 - 39000609
Alignment:
| Q |
1 |
ttttgtaattttcgtatatttatggactaaatgacaaggactcacaaaaattactatttacacttctttctttggtgttttg-----ctttgcttgataa |
95 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
39000385 |
ttttgtaattttcgtatattcatggactaaatgacaagaactcacaaaaattactatttacacttctttctttcgtgttttgctttgctttgcttgataa |
39000484 |
T |
 |
| Q |
96 |
tgcagcttccgtatttagtgcataatttcctccactcatagtattggtgttggaggacccacttgccactatcttcattatcactcattccactcaatct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000485 |
tgcagcttccgtatttagtgcataatttcctccactcatagtattggtgttggaggacccacttgccactatcttcattatcactcattccactcaatct |
39000584 |
T |
 |
| Q |
196 |
ttcaatagataccatccctatgctt |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39000585 |
ttcaatagataccatccctatgctt |
39000609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University