View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10449_low_17 (Length: 223)
Name: NF10449_low_17
Description: NF10449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10449_low_17 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 30409424 - 30409204
Alignment:
| Q |
1 |
gaatgggaagtgtatggttttcgttaagctaagccccctttgaatttgagttaaaagaaaacatctaaactctaaacacaataaagtgttgcgttatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409424 |
gaatgggaagtgtatggttttcgttaagctaagccc--tttgaatttgagttaaaagaaaacatctaaactctaaacacaataaagtgttgcgttatttg |
30409327 |
T |
 |
| Q |
101 |
aatatcaaaatacatacatcacattatgcagaggggtcatatcagaggacattatatttaacatcaaattaaaacttctcataaagaaaactgcaactgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409326 |
aatatcaaaatacatacatcacattatgcagaggggtcatatcagaggacattatatttaacatcaaattaaaacttctcataaagaaaactgcaactgc |
30409227 |
T |
 |
| Q |
201 |
caatattgacttaaaaaagattt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30409226 |
caatattgacttaaaaaagattt |
30409204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 39 - 85
Target Start/End: Complemental strand, 30411898 - 30411848
Alignment:
| Q |
39 |
tttgaatttgagttaaaa----gaaaacatctaaactctaaacacaataaa |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30411898 |
tttgaatttgagttaaaatatagaaaacatctaaactctaaatacaataaa |
30411848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University