View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10450_high_8 (Length: 232)
Name: NF10450_high_8
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10450_high_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 32773143 - 32773361
Alignment:
| Q |
14 |
aggcaaccaaaaagatagaacaaaatttgggaattttttaacaacccaattgccttatttgataataagaaattcaaagaacaaaagaaattgtacccag |
113 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32773143 |
aggcaaccaaaaagaaagaacaaaatttgggaattttttaacaacctaattgccttatttgataataagaaattcgaagaacaaaagaaattgtacccag |
32773242 |
T |
|
| Q |
114 |
atttattgttcgaatatgaatcttcgataattctagagttttctttacataacaaagacataggttttaagttcaaattatttagttcatgcttgactac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
32773243 |
atttattgttcgaatatgaatcttcgataattctagagttttctagacataataaagacataggttttaagttcaaattttttagttcatgcttaactac |
32773342 |
T |
|
| Q |
214 |
agttcatgtagtttacacc |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32773343 |
agttcatgtagtttacacc |
32773361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University