View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10450_low_11 (Length: 278)
Name: NF10450_low_11
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10450_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 26669374 - 26669102
Alignment:
| Q |
1 |
attttcacctttcagcggcccaataacagacaatataggaagcagataagccaatgtcttccccgaacccgtatacgactgaattatcacatcacggttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669374 |
attttcacctttcagcggcccaataacagacaatataggaagcagataagccagtgtcttccccgaacccgtatacgactgaattatcacatcacggttc |
26669275 |
T |
|
| Q |
101 |
ttcaaaatggtaggcaccgcagcagactgaacatcagtcggaacattaaaaccctcttttcctaacctctcaatcaacacttccggaataccgagttccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669274 |
ttcaaaatggtaggcaccgcagcagactgaacatcagtcggaacattaaaaccctcttttcctaacctctcaatcaacacttccggaataccgagttccg |
26669175 |
T |
|
| Q |
201 |
aaaaagacttagcagcaaaaggggcattctctatttcttttctctctttaaccctaacacttttcttctcact |
273 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26669174 |
aaaacgacttagcagcaaaaggggcattctctatttcttttctctctttaatcctaacacttttcttctcact |
26669102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University