View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10450_low_12 (Length: 272)
Name: NF10450_low_12
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10450_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 27 - 255
Target Start/End: Original strand, 39915976 - 39916205
Alignment:
| Q |
27 |
ccaacgtttatgtgagtttaaccctgttgataagaacattacattatatacaacgattggggtttgaaatcttaattttccaattattcatcttaattta |
126 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39915976 |
ccaacgtctatgtgagtttaaccctattgataagaacattacattatatacaacgattggggtttgaaatcttaattttccaattattcatcttaattta |
39916075 |
T |
|
| Q |
127 |
ttattgtataatcactaaacgacatgnnnnnnnntatacatttatcatgaacaannnnnnnatgaaca-tttttgttatcataaacatgctaatttatta |
225 |
Q |
| |
|
||||| |||| ||||||||||||||| |||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
39916076 |
ttattttatagtcactaaacgacatgaaaaaaaatatacatttatcatgaacaatttttttatgaacatttttttttatcataaacatgctaatttatta |
39916175 |
T |
|
| Q |
226 |
ttgtatagtcactacacaacatgaaaaaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39916176 |
ttgtatagtcactacacaacatgaaaaaat |
39916205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University