View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10450_low_14 (Length: 238)

Name: NF10450_low_14
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10450_low_14
NF10450_low_14
[»] chr4 (1 HSPs)
chr4 (1-223)||(52988331-52988553)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 52988553 - 52988331
Alignment:
1 tcatcaaggaagctgcgacaagagtcgagatggagtccagaagcataatattgaaaacaagtgttgttcagattttcatgatttgaatctaaatgcagaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
52988553 tcatcaaggaagctgcgacaagagtcgagatggagtccagaagcataatattgaaaacaagttttgttcagattttcatgatttgaatctaaatgcagaa 52988454  T
101 gatattggtgcagatgcggtgaacagtcatggcaattgccagggacataagtcccacgggacaaaacactgccataacaaaaatatcaacatggatactc 200  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
52988453 gatattggagcagatgcggtgaacagtcatggcaattgccagggacataagtcccacgggacaaaacactgccattacaaaaatatcaacatggatactc 52988354  T
201 atgatcacacttcacttggttct 223  Q
    |||||||||||||||||||||||    
52988353 atgatcacacttcacttggttct 52988331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University