View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10450_low_18 (Length: 218)
Name: NF10450_low_18
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10450_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 50564995 - 50564798
Alignment:
| Q |
18 |
cttttcttcctctaactattgttttagagttttatgacttatgaggagtattttagatatttatttgaaagattgtggatgtattgtggg--------tt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50564995 |
cttttcttcctctaactattgttttagagttttatgacttatgatgagtattttagatatttatttgaaagattgtggatgtattgtggggttgtgggtt |
50564896 |
T |
 |
| Q |
110 |
tgagtctttgagagaaatgtatgtgttgtagacttttcaaatagtgtaattctctgatagttattagaaaacgattatggttttattttgtccctttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50564895 |
tgagtctttgagagaaatgtatgtgttgtagacttttcaaatagtgtaattctctgatagttattagaaaacgattatggttttattttgtccctttg |
50564798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University