View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10450_low_19 (Length: 205)
Name: NF10450_low_19
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10450_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 26627303 - 26627479
Alignment:
| Q |
15 |
agagagcgaaatccgtgacattttttgctgtcgtaagatctaacatgatcgtattaccggatcagttgtctgtttaagcctttgaatcgaaaatttgcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26627303 |
agagagcgaaatccgtgacattttttgctgtcgtaagatctaacatgatcgtattaccggatcagttgtctgtttaagcctttgaatcgaaaatttgcac |
26627402 |
T |
|
| Q |
115 |
aaagttatagggagaagacaactccttatagaannnnnnnaatgtaaatgaccattgtgcttttattggtagtaatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26627403 |
aaagttatagggagaagacaactccttatagaaattttttaatgtaaatgaccattgtgcttttattggtagtaatt |
26627479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 147
Target Start/End: Original strand, 50941363 - 50941419
Alignment:
| Q |
92 |
gcctttgaatcgaaaattt-gcacaaagttatagggagaagacaactccttatagaa |
147 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
50941363 |
gcctttgaatcgaaaattttgcacaaagttataaggagaagacaactctttatagaa |
50941419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 147
Target Start/End: Original strand, 50941114 - 50941155
Alignment:
| Q |
106 |
aatttgcacaaagttatagggagaagacaactccttatagaa |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50941114 |
aatttgcacaaagttatagggagaagacaactctttatagaa |
50941155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University