View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10450_low_5 (Length: 421)
Name: NF10450_low_5
Description: NF10450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10450_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 17 - 406
Target Start/End: Complemental strand, 26669755 - 26669366
Alignment:
| Q |
17 |
atggtctgcacccgatctcctcccaacatgctccaataacctgtgcatgtcttcccgaaaattgaacgaaaggagctcgtcaacttcatctaataccaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669755 |
atggtctgcacccgatctcctcccaacatgctccaataacctgtgcatgtcttcccgaaaattgaacgaaaggagctcgtcaacttcatctaataccaag |
26669656 |
T |
|
| Q |
117 |
tattgacagccatgagtacgaagtttcccacttgcactaagctcggctatcctaccaggcgtaccaacaacaatagcaggtttgtttttcttaagggctt |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669655 |
tattgacagccatgagcacgaagtttcccacttgcactaagctcggctatcctaccaggcgtaccaacaacaatagcaggtttgtttttcttaagggctt |
26669556 |
T |
|
| Q |
217 |
cttcctgcctggttcggttcgcacctcccacaagctgctgaaccactttcctgttttccattcccaatatcttctcaaactccctaactatctgcattcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669555 |
cttcctgcctggttcggttcgcacctcccacaagctgctgaaccactttcctgttttccattcccaatatcttctcaaactccctaactatctgcattcc |
26669456 |
T |
|
| Q |
317 |
aagctcccttgaaggagcaacaatcaccgcttctactcccaatttcttcccagcctcaccaccatcacctcccccttcattattttcacc |
406 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26669455 |
aagctccctcgaaggagcaacaatcaccgcttctactcccaatttcttcccagactcaccaccatcacctcccccttcattattttcacc |
26669366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University