View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_high_24 (Length: 211)
Name: NF10451_high_24
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 13 - 143
Target Start/End: Complemental strand, 22299264 - 22299134
Alignment:
| Q |
13 |
agatgaattaaataaaaatgatagtgtgatgcataatatatgctcaagtttagaaaattgatcaaaggaaagaaagttaagagggtgaaaattctaattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22299264 |
agatgaattaaataaaaatgatagtgtgatgcataatatatgctcaagtttagaaaattgatcaaaggaaagaaagttaagagggtgaaaattctaattt |
22299165 |
T |
|
| Q |
113 |
ggctagcaactattctggtcgtgatttgtta |
143 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
22299164 |
ggctagcaaccattctggtcgtgatttgtta |
22299134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 124
Target Start/End: Complemental strand, 29219906 - 29219848
Alignment:
| Q |
67 |
aaattgatcaaaggaaagaaa-gttaagagggtgaaaattctaatttggctagcaacta |
124 |
Q |
| |
|
|||||||||||| |||| ||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
29219906 |
aaattgatcaaatgaaaaaaaagccaagagggtgaaaattctaatttggctagaaacta |
29219848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University