View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_14 (Length: 298)
Name: NF10451_low_14
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 121 - 293
Target Start/End: Original strand, 3900413 - 3900585
Alignment:
| Q |
121 |
agttctactgtttgtttgattgctgctctccatattggttcttatattttatcgatcgacttcctattgatttttatatttgatagattttctcttcatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
3900413 |
agttctactgtttgtttgattgctgctctccatattggttcttatattttatcgatcgacttcctattgatttttatatttgatagtttttctctttatg |
3900512 |
T |
 |
| Q |
221 |
ggttgttatgtttggttacctctatatatatattacttcttttgtttcggttgttctctcctcctttgcttct |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
3900513 |
ggttgttatgtttggttacctctatatatatattacttcttttgtttcggttgttctctccttctttggttct |
3900585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 59 - 124
Target Start/End: Original strand, 3900143 - 3900208
Alignment:
| Q |
59 |
aaaaattcaatgagttcttcagatgatgtaattgatagtggtgtgattggtggggcagccaaagtt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3900143 |
aaaaattcaatgagttcttcagatgatgtaattgatagtggtgtcattggtggggcagccaaagtt |
3900208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University