View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_15 (Length: 277)
Name: NF10451_low_15
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 105 - 259
Target Start/End: Original strand, 45596141 - 45596295
Alignment:
| Q |
105 |
ccaacaagagtttgtatctactgatataccttccccatctgttcaatgtgaggagaaaaacgaagagcttcataacaagcacggcagcgaagcttttgaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596141 |
ccaacaagagtttgtatctactgatataccttccccatctgttcaatgcgaggagaaaaacgaagagcttcataacaagcacggcagcgaagcttttgaa |
45596240 |
T |
 |
| Q |
205 |
tatcttgaggtagatggttatttgctagtcgagaatctgatttggaagcttgaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596241 |
tatcttgaggtagatggttatttgctagtcgagaatctgatttggaagcttgaat |
45596295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 38
Target Start/End: Original strand, 45596039 - 45596074
Alignment:
| Q |
3 |
aggaccatatgatctcatcctctccaccaatatctg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596039 |
aggaccatatgatctcatcctctccaccaatatctg |
45596074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 128 - 253
Target Start/End: Original strand, 27151886 - 27152011
Alignment:
| Q |
128 |
atataccttccccatctgttcaatgtgaggagaaaaacgaagagcttcataacaagcacggcagcgaagcttttgaatatcttgaggtagatggttattt |
227 |
Q |
| |
|
||||||||| || || |||||||| ||||||| ||||| || |||||||| ||||| ||||| |||||||||||||| ||| ||||||||| ||| || |
|
|
| T |
27151886 |
atatacctttcctatttgttcaatacgaggagagaaacggagtgcttcatagcaagctcggcaacgaagcttttgaatgtctggaggtagattgttgttc |
27151985 |
T |
 |
| Q |
228 |
gctagtcgagaatctgatttggaagc |
253 |
Q |
| |
|
||||| || ||||| ||||| ||||| |
|
|
| T |
27151986 |
gctagccgtgaatcggattttgaagc |
27152011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University