View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_16 (Length: 272)
Name: NF10451_low_16
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 56 - 258
Target Start/End: Original strand, 21640918 - 21641120
Alignment:
| Q |
56 |
tatatataatgttccttgtaatttaggtttcattaattgtgatacgtatcaaatatatgtgactatagttttaggtatctcgtgtaaccttgttttgctg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21640918 |
tatatataatgttccttgtaatttaggtttcattaattgtggtacgtatcaaatatatgcgcctatagttttaggtatctcgtgtaaccttgttttgctg |
21641017 |
T |
|
| Q |
156 |
aagaagcaaaggctttgattgattgttttctctcttataatttatcttataacaaacctatattcattaatgtacgtatgatcactttcatttcattcca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641018 |
aagaagcaaaggctttgattgattgttttctctcttataatttatcttttaacaaacctatactcattaatgtacgtatgatcactttcatttcattcca |
21641117 |
T |
|
| Q |
256 |
tcc |
258 |
Q |
| |
|
||| |
|
|
| T |
21641118 |
tcc |
21641120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 21640860 - 21640892
Alignment:
| Q |
17 |
aataataatatcaatgagttcacaccatatata |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21640860 |
aataataatatcaatgagttcacaccatatata |
21640892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University