View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_17 (Length: 269)
Name: NF10451_low_17
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 98 - 254
Target Start/End: Complemental strand, 47201548 - 47201392
Alignment:
| Q |
98 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201548 |
caggttgggttggcaccactttgggatgatgggtatgggaatcgcactgttgaagattactttgctgcatccaaagagatttgcaagtttgatggtggcc |
47201449 |
T |
|
| Q |
198 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccaccc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201448 |
caccacgttggttttgcccaatcgaatgtgcttctcctttccaaggttctcccaccc |
47201392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 47201645 - 47201579
Alignment:
| Q |
1 |
ttctgttgttgttgaaacaaaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201645 |
ttctgttgttgttgaaacaaaccaaaacaaggttcctcttttattgcgttctactaataatgttgtt |
47201579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University