View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_22 (Length: 250)
Name: NF10451_low_22
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_22 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0050 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 4385 - 4149
Alignment:
| Q |
10 |
gcacagatagttagagaccataattttcataaaattgctttttgcaccaaacaagacacacacaa---aggagctaattaatatgtcaatttcatgtctc |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4385 |
gcacagagagttagagaccataattttcataaaattgctttttgcaccaaacaa--cacacacaagttaggagctaattaatatgtcaatttcatgtctc |
4288 |
T |
|
| Q |
107 |
acaaaagtgtttcatatttaatgtcacacttaagtaaagtaatataaaggtcacttagctttgaagccaagtagaattcgatggttacttgtctagcatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4287 |
acaaaagtgtttcatatttaatgtcacacttaagtaaagtaatataaaggtcacttagctttgaagccaagtagaattcgatggttacttgtctagcatg |
4188 |
T |
|
| Q |
207 |
caaagctttacacgttctttgttaagctcatatttctcat |
246 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4187 |
caaagctttacacgttc-ttgttaagctcatatttctcat |
4149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University