View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_23 (Length: 250)
Name: NF10451_low_23
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 22300117 - 22299877
Alignment:
| Q |
2 |
acgaaaaagttatacaccttctgttcctagattgtcacttttgtttcaannnnnnnngttaa-tatttagtattcagtctccaaatgatataagcctcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||| | |
|
|
| T |
22300117 |
acgaaaaagttatacaccttctgttcctagattgtcacttttgtttcaattttttttgttaaatattcagtattcagtctccaaatgatataagcctcat |
22300018 |
T |
 |
| Q |
101 |
taaaacatgtgattagattcaaatgattggtcacttcaccaaataacaaaatatttgaaaaattccgagtacgattctcacgtggaacaatacttaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||| ||| |
|
|
| T |
22300017 |
taaaacatgtgattagattcaaatgattggtcacttcaccaaataacaaaatatttgaaaaaatccgagtaggattctcacgtggaagaatacttagttt |
22299918 |
T |
 |
| Q |
201 |
atttatacttaccttacgattaaactttaaattttctgtgc |
241 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22299917 |
atctatacttaccttacggttaaactttaaattttctgtgc |
22299877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University