View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_29 (Length: 240)
Name: NF10451_low_29
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 25134241 - 25134449
Alignment:
| Q |
18 |
aaaagcttactacaaatgtgccctgactggtagtccatgcagtatgaatatcttctttcctcacggaagcacagctgtgttagtttctcctgctccacaa |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25134241 |
aaaagcttactacaaatgtgccttgactggtagtccatgcagtatgaatatcttctttcctcacggaagcacagctgtgttagtttctcctgctccacaa |
25134340 |
T |
 |
| Q |
118 |
caggcaagattattattatattacttgcttcaagtaaattgtcatccttaaaaatcttaagtggagataattttttaatgaggcaacccagtattctggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25134341 |
caggcaagattattattatattacttgcttcaaataaattgtcatccttataaatcttaagtggagataattttttaatgaggcaacccagtattctggt |
25134440 |
T |
 |
| Q |
218 |
ttatctctg |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
25134441 |
ttatctctg |
25134449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University