View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10451_low_33 (Length: 219)
Name: NF10451_low_33
Description: NF10451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10451_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 41686578 - 41686727
Alignment:
| Q |
1 |
ataatgtgctccttgctgaagttttaatcaagaaaacaaaagcaaggctttatttaaattttcagctctataccatactatgacatatgaataatgagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686578 |
ataatgtgctccttgctgaagttttaatcaagaaaacaaaagcaaggctttatttaaattttcagctctataccatactatgacatatgaataatgagaa |
41686677 |
T |
|
| Q |
101 |
acacgcttaatcggaacaatctaaattctacataatcatcaagctatagt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686678 |
acacgcttaatcggaacaatctaaattctacataatcatcaagctatagt |
41686727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 75 - 133
Target Start/End: Complemental strand, 5482152 - 5482094
Alignment:
| Q |
75 |
atactatgacatatgaataatgagaaacacgcttaatcggaacaatctaaattctacat |
133 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
5482152 |
atactatgacatattaatagtgagaaacacacttaatcagaacaatctaaactctacat |
5482094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University